Nested Structures

Nested lists and nested dictionaries organize data into a hierarchical format. Programmers often have to choose between different nested representations depending on the problem at hand.

food_list = [
    ["Agua Verde", "Montlake", 4.3],
    ["Bangrak", "Belltown", 4.8],
    ["Crackle Mi", "Ballard", 4.4]
]

# Accessing Bangrak's rating requires knowing the exact indices:
food_list[1][2]

food_dict = {
    "Agua Verde": {"Neighborhood": "Montlake", "Rating": 4.3},
    "Bangrak": {"Neighborhood": "Belltown", "Rating": 4.8},
    "Crackle Mi": {"Neighborhood": "Ballard", "Rating": 4.4}
}

# Accessing Bangrak's rating uses meaningful keys:
food_dict["Bangrak"]["Rating"]

Problem solving strategy¶

Use these iterative development strategies to break down complex problems:

1. Relate inputs to outputs: What data types are you given? What data types do you need to return?

2. Solve a subproblem: Can you solve a smaller problem first? What about the nested, inner structure?

3. Combine subproblem solutions: After working on the subproblem, how can you address the larger problem?

Practice: Olympic grouping¶

Imagine you are given a file olympics.txt containing each 2026 Winter Olympics discipline and its corresponding location:

Ice Hockey: Milan
Cross-Country Skiing: Tesero
Speed Skating: Milan
Alpine Skiing: Cortina
Freestyle Skiing: Livigno
Figure Skating: Milan

Create a dictionary where each location is a key. The value for a location should be a list of all Olympic disciplines taking place at that location. For example, the location “Milan” should evaluate to ['Ice Hockey', 'Speed Skating', 'Figure Skating'].

Practice: Triply-nested lists¶

Consider a triply-nested list representing a grid of color pixels. Each innermost list contains Red, Green, and Blue (RGB) values. For each pixel, set all three color values to the highest of that pixel’s three RGB values.

pixel_grid = [
    [[128, 50, 20], [50, 50, 60]],
    [[75, 67, 90], [42, 240, 100]]
]

Practice: RNA translation¶

RNA sequences consist of the letters A, U, C, and G. Each triplet of nucleotides translates to an amino acid based on a known mapping.

rna_mapping = {
    "AUG": "Methionine",
    "UGC": "Cysteine",
    "UCU": "Serine"
}

Use a for loop, range, and string slicing to translate an RNA sequence into a list of amino acids. Triplets that don’t match any known mapping are ignored.

sequence_1 = "AUGCUCAUG"
# ['Methionine', 'Methionine']

sequence_2 = "ACCUUUAUGAUUUGCUCUUUUUGCUCU"
# ['Methionine', 'Cysteine', 'Serine', 'Cysteine', 'Serine']